Six ways to Sunday: approaches to computational reproducibility in non-model system sequence analysis. презентация

Содержание

Слайд 1Six ways to Sunday: approaches to computational reproducibility in non-model system

sequence analysis.

C. Titus Brown
ctb@msu.edu
May 21, 2014


Слайд 2Hello!
Assistant Professor; Microbiology; Computer Science; etc.

More information at:

ged.msu.edu/
github.com/ged-lab/
ivory.idyll.org/blog/
@ctitusbrown


Слайд 3The challenges of non-model sequencing
Missing or low quality genome reference.

Evolutionarily distant.

Most

extant computational tools focus on model organisms –
Assume low polymorphism (internal variation)
Assume reference genome
Assume somewhat reliable functional annotation
More significant compute infrastructure
…and cannot easily or directly be used on critters of interest.


Слайд 4Shotgun sequencing & assembly
http://eofdreams.com/library.html;
http://www.theshreddingservices.com/2011/11/paper-shredding-services-small-business/;
http://schoolworkhelper.net/charles-dickens%E2%80%99-tale-of-two-cities-summary-analysis/


Слайд 5Shotgun sequencing analysis goals:
Assembly (what is the text?)
Produces new genomes &

transcriptomes.
Gene discovery for enzymes, drug targets, etc.
Counting (how many copies of each book?)
Measure gene expression levels, protein-DNA interactions
Variant calling (how does each edition vary?)
Discover genetic variation: genotyping, linkage studies…
Allele-specific expression analysis.

Слайд 6Assembly
It was the best of times, it was the wor
, it

was the worst of times, it was the
isdom, it was the age of foolishness
mes, it was the age of wisdom, it was th


It was the best of times, it was the worst of times, it was the age of wisdom, it was the age of foolishness

…but for lots and lots of fragments!

Слайд 7
Shared low-level fragments may not reach the threshold for assembly.

Lamprey mRNAseq:
Pooling

all your data is important

Слайд 8Introducing k-mers
CCGATTGCACTGGACCGA (

TGCACTGGAC
GCACTGGACC
ACTGGACCGA


Слайд 9K-mers give you an implicit alignment

CCGATTGCACTGGACCGATGCACGGTACCGTATAGCC
CATGGACCGATTGCACTGGACCGATGCACGGTACCG




Слайд 10K-mers give you an implicit alignment

CCGATTGCACTGGACCGATGCACGGTACCGTATAGCC
CATGGACCGATTGCACTGGACCGATGCACGGTACCG
CATGGACCGATTGCACTGGACCGATGCACGGACCG



(with no accounting for mismatches or indels)


Слайд 11De Bruijn graphs – assemble on overlaps
J.R. Miller et al. /

Genomics (2010)

Слайд 12The problem with k-mers

CCGATTGCACTGGACCGATGCACGGTACCGTATAGCC
CATGGACCGATTGCACTCGACCGATGCACGGTACCG

Each sequencing

error results in k novel k-mers!

Слайд 13Conway T C , Bromage A J Bioinformatics 2011;27:479-486
© The Author

2011. Published by Oxford University Press. All rights reserved. For Permissions, please email: journals.permissions@oup.com

Assembly graphs scale with data size, not information.


Слайд 14Practical memory measurements (soil)
Velvet measurements (Adina Howe)


Слайд 15Data set size and cost
$1000 gets you ~100m “reads”, or about

10-40 GB of data, in ~week.

> 1000 labs doing this regularly.

Each data set analysis is ~custom.

Analyses are data intensive and memory intensive.

Слайд 16Efficient data structures & algorithms


Слайд 17Shotgun sequencing is massively redundant; can we eliminate redundancy while retaining

information?

Analog: JPEG lossy compression


Слайд 18Sparse collections of k-mers can be stored efficiently in Bloom filters
Pell

et al., 2012, PNAS; doi: 10.1073/pnas.1121464109

Слайд 19Data structures & algorithms papers

“These are not the k-mers you are

looking for…”, Zhang et al., arXiv 1309.2975, in review.

“Scaling metagenome sequence assembly with probabilistic de Bruijn graphs”, Pell et al., PNAS 2012.

“A Reference-Free Algorithm for Computational Normalization of Shotgun Sequencing Data”, Brown et al., arXiv 1203.4802, under revision.

Слайд 20Data analysis papers

“Tackling soil diversity with the assembly of large, complex

metagenomes”, Howe et al., PNAS, 2014.

Assembling novel ascidian genomes & transcriptomes, Lowe et al., in prep.

A de novo lamprey transcriptome from large scale multi-tissue mRNAseq, Scott et al., in prep.

Слайд 21Lab approach – not intentional, but working out.


Слайд 22This leads to good things.
(khmer software)


Слайд 23Current research
(khmer software)


Слайд 24Testing & version control – the not so secret sauce
High test

coverage - grown over time.

Stupidity driven testing – we write tests for bugs after we find them and before we fix them.

Pull requests & continuous integration – does your proposed merge break tests?

Pull requests & code review – does new code meet our minimal coding etc requirements?
Note: spellchecking!!!

Слайд 25On the “novel research” side:


Novel data structures and algorithms;
Permit low(er) memory

data analysis;
Liberate analyses from specialized hardware.


Слайд 26Running entirely w/in cloud
Complete data; AWS m1.xlarge
~40 hours
(See PyCon 2014 talk;

video and blog post.)

MEMORY


Слайд 27On the “novel research” side:


Novel data structures and algorithms;
Permit low(er) memory

data analysis;
Liberate analyses from specialized hardware.

This last bit? => reproducibility.

Слайд 28Reproducibility! Scientific progress relies on reproducibility of analysis. (Aristotle, Nature, 322 BCE.)
“There

is no such thing as ‘reproducible science’. There is only ‘science’, and ‘not science.’” – someone on Twitter (Fernando Perez?)

Слайд 29Disclaimer

Not a researcher of reproducibility!

Merely a practitioner.

Please take my points below

as an argument and not as research conclusions.

(But I’m right.)

Слайд 30My usual intro:
We practice open science!

Everything discussed here:
Code: github.com/ged-lab/ ; BSD

license
Blog: http://ivory.idyll.org/blog (‘titus brown blog’)
Twitter: @ctitusbrown
Grants on Lab Web site: http://ged.msu.edu/research.html
Preprints available.

Everything is > 80% reproducible.



Слайд 31My usual intro:
We practice open science!

Everything discussed here:
Code: github.com/ged-lab/ ; BSD

license
Blog: http://ivory.idyll.org/blog (‘titus brown blog’)
Twitter: @ctitusbrown
Grants on Lab Web site: http://ged.msu.edu/research.html
Preprints available.

Everything is > 80% reproducible.



Слайд 32My lab & the diginorm paper.
All our code was already on

github;
Much of our data analysis was already in the cloud;
Our figures were already made in IPython Notebook
Our paper was already in LaTeX


Слайд 33IPython Notebook: data + code =>


Слайд 34My lab & the diginorm paper.
All our code was already on

github;
Much of our data analysis was already in the cloud;
Our figures were already made in IPython Notebook
Our paper was already in LaTeX

…why not push a bit more and make it easily reproducible?

This involved writing a tutorial. And that’s it.

Слайд 35To reproduce our paper:


git clone && python setup.py install
git clone


cd pipeline
wget && tar xzf
make && cd ../notebook && make
cd ../ && make

Слайд 36Now standard in lab --
All our papers now have:

Source hosted on

github;
Data hosted there or on AWS;
Long running data analysis => ‘make’
Graphing and data digestion => IPython Notebook (also in github)

Qingpeng Zhang


Слайд 37Research process


Слайд 38Literate graphing & interactive exploration


Слайд 39The process

We start with pipeline reproducibility
Baked into lab culture; default “use

git; write scripts”

Community of practice!

Use standard open source approaches, so OSS developers learn it easily.
Enables easy collaboration w/in lab
Valuable learning tool!


Слайд 40Growing & refining the process

Now moving to Ubuntu Long-Term Support +

install instructions.

Everything is as automated as is convenient.

Students expected to communicate with me in IPython Notebooks.

Trying to avoid building (or even using) new tools.

Avoid maintenance burden as much as possible.

Слайд 411. Use standard OS; provide install instructions


Providing install, execute for Ubuntu

Long-Term Support release 14.04: supported through 2017 and beyond.

Avoid pre-configured virtual machines!
Locks you into specific cloud homes.
Challenges remixability and extensibility.


Слайд 422. Automate

Literate graphing now easy with knitr and IPython Notebook.

Build automation

with make, or whatever. To first order, it does not matter what tools you use.

Explicit is better than implicit. Make it easy to understand what you’re doing and how to extend it.

Слайд 43Myths of reproducible research



(Opinions from personal experience.)


Слайд 44Myth 1: Partial reproducibility is hard.
“Here’s my script.” => Methods

More

generally,
Many scientists cannot replicate any part of their analysis without a lot of manual work.
Automating this is a win for reasons that have nothing to do with reproducibility… efficiency!

See: Software Carpentry.

Слайд 45Myth 2: Incomplete reproducibility is useless

Paraphrase: “We can’t possibly reproduce the

experimental data exactly, so we shouldn’t bother with anything else, either.”
(Analogous arg re software testing & code coverage.)

…I really have a hard time arguing the paraphrase honestly…
Being able to reanalyze your raw data? Interesting.
Knowing how you made your figures? Really useful.


Слайд 46Myth 3: We need new platforms

Techies always want to build something

(which is fun!) but don’t want to do science (which is hard!)

We probably do need new platforms, but stop thinking that building them does a service.

Platforms need to be use driven. Seriously.

If you write good software for scientific inquiry and make it easy to use reproducibly, that will drive virtuousity.

Слайд 47Myth 4. Virtual Machine reproducibility is an end solution.

Good start! Better

than nothing!

But:
Limits understanding & reuse.
Limits remixing: often cannot install other software!

“Chinese Room” argument: could be just a lookup table.

Слайд 48Myth 5: We can use GUIs for reproducible research
(OK, this is

partly just to make people think ;)

Almost all data analysis takes place within a larger pipeline; the GUI must consume entire pipeline in order to be reproducible.

IFF GUI wraps command line, that’s a decent compromise (e.g. Galaxy) but handicaps researchers using novel approaches.

By the time it’s in a GUI, it’s no longer research.


Слайд 49Our current efforts?

Semantic versioning of our own code: stable command-line interface.

Writing

easy-to-teach tutorials and protocols for common analysis pipelines.

Automate ‘em for testing purposes.

Encourage their use, inclusion, and adaptation by others.

Слайд 50khmer-protocols


Слайд 51khmer-protocols:
Provide standard “cheap” assembly protocols for the cloud.

Entirely copy/paste; ~2-6 days

from raw reads to assembly, annotations, and differential expression analysis. ~$150 per data set (on Amazon rental computers)

Open, versioned, forkable, citable….

Слайд 52Literate testing
Our shell-command tutorials for bioinformatics can now be executed in

an automated fashion – commands are extracted automatically into shell scripts.

See: github.com/ged-lab/literate-resting/.

Tremendously improves peace of mind and confidence moving forward!

Leigh Sheneman


Слайд 53Doing things right => #awesomesauce


Слайд 54Concluding thoughts
We are not doing anything particularly neat on the computational

side... No “magic sauce.”

Much of our effort is now driven by sheer utility:
Automation reduces our maintenance burden.
Extensibility makes revisions much easier!
Explicit instructions are good for training.

Some effort needed at the beginning, but once practices are established, “virtuous cycle” takes over.

Слайд 55What bits should people adopt?

Version control!

Literate graphing!

Automated “build” from data =>

results!

Make available data as early in your pipeline as possible.

Слайд 56More concluding thoughts

Nobody would care that we were doing things reproducibly

if our science wasn’t decent.

Make sure students realize that faffing about on infrastructure isn’t science.

Research is about doing science. Reproducibility (like other good practices) is much easier to proselytize if you can link it to progress in science.


Слайд 57Biology & sequence analysis is in a perfect place for reproducibility

We

are lucky! A good opportunity!

Big Data: laptops are too small;
Excel doesn’t scale any more;
Few tools in use; most of them are $$ or UNIX;
Little in the way of entrenched research practice;

Слайд 58Thanks!


Talk is on slideshare: slideshare.net/c.titus.brown

E-mail or tweet me:
ctb@msu.edu
@ctitusbrown


Обратная связь

Если не удалось найти и скачать презентацию, Вы можете заказать его на нашем сайте. Мы постараемся найти нужный Вам материал и отправим по электронной почте. Не стесняйтесь обращаться к нам, если у вас возникли вопросы или пожелания:

Email: Нажмите что бы посмотреть 

Что такое ThePresentation.ru?

Это сайт презентаций, докладов, проектов, шаблонов в формате PowerPoint. Мы помогаем школьникам, студентам, учителям, преподавателям хранить и обмениваться учебными материалами с другими пользователями.


Для правообладателей

Яндекс.Метрика